Number of conditions
Number of seed genes
Number of extended seed genes
Correlation extended seed
No. (putative) regulators in module
=
=
=
=
=
80
4
4
0.93483
1
[View full size image]
![[View full size image]](./ExpressionProfiles/ExpressionProfile_seed_module_98.png){kind=link}
[View full size image]
| Number of motifs Number of conditions Number of seed genes Number of extended seed genes Correlation extended seed No. (putative) regulators in module | = = = = = = | 1 80 4 4 0.93483 1 | [View full size image] | [View full size image] |
| Motif | Motif logo | Module motif logo |
|---|---|---|
| TyrR: transcriptional regulation of aroF, aroG, tyrA and aromatic amino acid transport |  |  |
| Gene | Seed/Extended Seed | Description | Direct interaction (RegulonDB) | Indirect interaction (RegulonDB) | Motif instance |
|---|---|---|---|---|---|
| b1894 (insA-5) | Seed | IS1 protein InsA | | AGGTGACATTAAAGCTTTACTCC | |
| b1323 (tyrR) | Seed | TyrR transcriptional dual regulator | TyrR | - | TTGTGTCAATGATTGTTGACAGA |
| b0112 (aroP) | Seed | AroP phenylalanine/tyrosine/tryptophan APC transporter | TyrR | - | TGATGTAAACAAATTAATACAAC |
| b1842 (holE) | Seed | DNA polymerase III, θ subunit | | TTTTGTAATAACTTTTTTACAGA |
![[View full size image]](./ExpressionProfiles/ExpressionProfile_extend_module_98.png){kind=link}