Number of motifs Number of conditions Number of seed genes Number of extended seed genes Correlation extended seed No. (putative) regulators in module | = = = = = = | 1 80 4 4 0.93483 1 | [View full size image] | [View full size image] |
Motif | Motif logo | Module motif logo |
---|---|---|
TyrR: transcriptional regulation of aroF, aroG, tyrA and aromatic amino acid transport |
Gene | Seed/Extended Seed | Description | Direct interaction (RegulonDB) | Indirect interaction (RegulonDB) | Motif instance |
---|---|---|---|---|---|
b1894 (insA-5) | Seed | IS1 protein InsA |    | AGGTGACATTAAAGCTTTACTCC | |
b1323 (tyrR) | Seed | TyrR transcriptional dual regulator | TyrR | - | TTGTGTCAATGATTGTTGACAGA |
b0112 (aroP) | Seed | AroP phenylalanine/tyrosine/tryptophan APC transporter | TyrR | - | TGATGTAAACAAATTAATACAAC |
b1842 (holE) | Seed | DNA polymerase III, θ subunit |    | TTTTGTAATAACTTTTTTACAGA |