Number of motifs Number of conditions Number of seed genes Number of extended seed genes Correlation extended seed No. (putative) regulators in module | = = = = = = | 2 82 4 9 0.79337 1 | [View full size image] | [View full size image] |
Motif | Motif logo | Module motif logo |
---|---|---|
Fur: negatively regulates a number of operons that encode enzymes involved in iron transport; activated by manganese; forms a homodimer | ||
CRP: cyclic AMP receptor protein |
Gene | Seed/Extended Seed | Description | Direct interaction (RegulonDB) | Indirect interaction (RegulonDB) | Motif instance |
---|---|---|---|---|---|
b0683 (fur) | Seed | Fur | Fur CRP | - + | ATGATACGCATTATCT AAATGTAAGCTGTGCCACGTTTT |
b0593 (entC) | Seed | isochorismate synthase 1 | Fur CRP | - + | ATGATAATCATTATTA AACGGCGCAGGACATCACATTGC |
b0805 (fiu) | Seed | putative outer membrane receptor for iron transport | Fur CRP | - + | ATCAAAATTATTATCA AATTATTATCACTTTCACGAGCA |
b0584 (fepA) | Seed | FepA, outer membrane receptor for ferric enterobactin (enterochelin) and colicins B and D | Fur CRP | - + | TTGATAACTATTTGCA TACTGTGCAATTTTTCATTGATT |
b0594 (entE) | Extension | EntE |       | - + |       |
b0583 (entD) | Extension |       | - + |       | |
b0592 (fepB) | Extension | FepB | Fur    | - | ATGAGAAGCATTATTG GATTGTGCGCTTTGTCGAATTTG |
b0596 (entA) | Extension | EntA |       | - + |       |
b2155 (cirA) | Extension | outer membrane receptor for iron-regulated colicin I receptor; porin; requires tonB gene product | Fur    | - + | TTGATAATTGTTATCG AGATGTGAGCGATAACCCATTTT |