Number of motifs Number of conditions Number of seed genes Number of extended seed genes Correlation extended seed No. (putative) regulators in module | = = = = = = | 1 77 4 4 0.93893 0 | [View full size image] | [View full size image] |
Motif | Motif logo | Module motif logo |
---|---|---|
Fis: Activates ribosomal RNA transcription. Plays a direct role in upstream activation of rRNA promoters |
Gene | Seed/Extended Seed | Description | Direct interaction (RegulonDB) | Indirect interaction (RegulonDB) | Motif instance |
---|---|---|---|---|---|
b3813 (uvrD) | Seed | DNA-dependent ATPase I and helicase II |    | CCTCGCTGATATAATCAGCAAA | |
b1185 (dsbB) | Seed | oxidoreductase that catalyzes reoxidation of DsbA protein disulfide isomerase I |    | TTTCGCCCGATAATTGTCCAAT | |
b2784 (relA) | Seed | b2784 | Fis | AAATAGTTGCGATTTGCCGATT | |
b2231 (gyrA) | Seed | DNA gyrase, subunit A | Fis | - | CATTGGATGTGAATAAAGCGTA |