Number of conditions
Number of seed genes
Number of extended seed genes
Correlation extended seed
No. (putative) regulators in module
=
=
=
=
=
77
4
4
0.93893
0
[View full size image]
![[View full size image]](./ExpressionProfiles/ExpressionProfile_seed_module_69.png){kind=link}
[View full size image]
| Number of motifs Number of conditions Number of seed genes Number of extended seed genes Correlation extended seed No. (putative) regulators in module | = = = = = = | 1 77 4 4 0.93893 0 | [View full size image] | [View full size image] |
| Motif | Motif logo | Module motif logo |
|---|---|---|
| Fis: Activates ribosomal RNA transcription. Plays a direct role in upstream activation of rRNA promoters |  |  |
| Gene | Seed/Extended Seed | Description | Direct interaction (RegulonDB) | Indirect interaction (RegulonDB) | Motif instance |
|---|---|---|---|---|---|
| b3813 (uvrD) | Seed | DNA-dependent ATPase I and helicase II | | CCTCGCTGATATAATCAGCAAA | |
| b1185 (dsbB) | Seed | oxidoreductase that catalyzes reoxidation of DsbA protein disulfide isomerase I | | TTTCGCCCGATAATTGTCCAAT | |
| b2784 (relA) | Seed | b2784 | Fis | AAATAGTTGCGATTTGCCGATT | |
| b2231 (gyrA) | Seed | DNA gyrase, subunit A | Fis | - | CATTGGATGTGAATAAAGCGTA |
![[View full size image]](./ExpressionProfiles/ExpressionProfile_extend_module_69.png){kind=link}