Number of conditions
Number of seed genes
Number of extended seed genes
Correlation extended seed
No. (putative) regulators in module
=
=
=
=
=
62
4
4
0.92662
0
[View full size image]
![[View full size image]](./ExpressionProfiles/ExpressionProfile_seed_module_68.png){kind=link}
[View full size image]
| Number of motifs Number of conditions Number of seed genes Number of extended seed genes Correlation extended seed No. (putative) regulators in module | = = = = = = | 1 62 4 4 0.92662 0 | [View full size image] | [View full size image] |
| Motif | Motif logo | Module motif logo |
|---|---|---|
| Fis: Activates ribosomal RNA transcription. Plays a direct role in upstream activation of rRNA promoters |  |  |
| Gene | Seed/Extended Seed | Description | Direct interaction (RegulonDB) | Indirect interaction (RegulonDB) | Motif instance |
|---|---|---|---|---|---|
| b2288 (nuoA) | Seed | NuoA | Fis | + | GAACGCACAAATAATCGCCTGA |
| b2296 (ackA) | Seed | b2296 | | CATTGGCTGAAAATTACGCAAA | |
| b2508 (guaB) | Seed | GuaB | Fis | + | CTCTGGTCGAGATATTGCCCAT |
| b4108 (yjdM) | Seed | conserved protein | | AATTGCGGCCTTTTTCGGCAAT |
![[View full size image]](./ExpressionProfiles/ExpressionProfile_extend_module_68.png){kind=link}