Number of motifs Number of conditions Number of seed genes Number of extended seed genes Correlation extended seed No. (putative) regulators in module | = = = = = = | 1 62 4 4 0.92662 0 | [View full size image] | [View full size image] |
Motif | Motif logo | Module motif logo |
---|---|---|
Fis: Activates ribosomal RNA transcription. Plays a direct role in upstream activation of rRNA promoters |
Gene | Seed/Extended Seed | Description | Direct interaction (RegulonDB) | Indirect interaction (RegulonDB) | Motif instance |
---|---|---|---|---|---|
b2288 (nuoA) | Seed | NuoA | Fis | + | GAACGCACAAATAATCGCCTGA |
b2296 (ackA) | Seed | b2296 |    | CATTGGCTGAAAATTACGCAAA | |
b2508 (guaB) | Seed | GuaB | Fis | + | CTCTGGTCGAGATATTGCCCAT |
b4108 (yjdM) | Seed | conserved protein |    | AATTGCGGCCTTTTTCGGCAAT |