Number of motifs Number of conditions Number of seed genes Number of extended seed genes Correlation extended seed No. (putative) regulators in module | = = = = = = | 1 55 4 4 0.94465 1 | [View full size image] | [View full size image] |
Motif | Motif logo | Module motif logo |
---|---|---|
Fis: Activates ribosomal RNA transcription. Plays a direct role in upstream activation of rRNA promoters |
Gene | Seed/Extended Seed | Description | Direct interaction (RegulonDB) | Indirect interaction (RegulonDB) | Motif instance |
---|---|---|---|---|---|
b3588 (aldB) | Seed | b3588 | Fis | - | GACTGGCGAAGATTTCGCCAGT |
b2549 (yphG) | Seed | conserved protein |    | AATTGCGTGATTATTCCGCGAA | |
b2550 (yphH) | Seed | predicted DNA-binding transcriptional regulator, NAGC-like |    | TTTCGCGGAATAATCACGCAAT | |
b3000 () | Seed | b3000 |    | GAGTGACGAAAAACTGGGCAAA |