Number of conditions
Number of seed genes
Number of extended seed genes
Correlation extended seed
No. (putative) regulators in module
=
=
=
=
=
55
4
4
0.94465
1
[View full size image]
![[View full size image]](./ExpressionProfiles/ExpressionProfile_seed_module_67.png){kind=link}
[View full size image]
| Number of motifs Number of conditions Number of seed genes Number of extended seed genes Correlation extended seed No. (putative) regulators in module | = = = = = = | 1 55 4 4 0.94465 1 | [View full size image] | [View full size image] |
| Motif | Motif logo | Module motif logo |
|---|---|---|
| Fis: Activates ribosomal RNA transcription. Plays a direct role in upstream activation of rRNA promoters |  |  |
| Gene | Seed/Extended Seed | Description | Direct interaction (RegulonDB) | Indirect interaction (RegulonDB) | Motif instance |
|---|---|---|---|---|---|
| b3588 (aldB) | Seed | b3588 | Fis | - | GACTGGCGAAGATTTCGCCAGT |
| b2549 (yphG) | Seed | conserved protein | | AATTGCGTGATTATTCCGCGAA | |
| b2550 (yphH) | Seed | predicted DNA-binding transcriptional regulator, NAGC-like | | TTTCGCGGAATAATCACGCAAT | |
| b3000 () | Seed | b3000 | | GAGTGACGAAAAACTGGGCAAA |
![[View full size image]](./ExpressionProfiles/ExpressionProfile_extend_module_67.png){kind=link}