Number of motifs Number of conditions Number of seed genes Number of extended seed genes Correlation extended seed No. (putative) regulators in module | = = = = = = | 1 106 4 4 0.92934 1 | [View full size image] | [View full size image] |
Motif | Motif logo | Module motif logo |
---|---|---|
LexA: Represses a number of genes involved in the response to DNA damage |
Gene | Seed/Extended Seed | Description | Direct interaction (RegulonDB) | Indirect interaction (RegulonDB) | Motif instance |
---|---|---|---|---|---|
b3673 (emrD) | Seed | EmrD multidrug MFS transporter |    | ACTGTTTATTTATACAGTAAA | |
b0227 (yafL) | Seed | predicted lipoprotein and C40 family peptidase |    | GCTGTATATTTATTCAGCTTG | |
b3501 (arsR) | Seed | ArsR transcriptional regulator |    | ACTGGATAATCATACAGTACA | |
b3391 (hofQ) | Seed | protein involved in utilization of DNA as a carbon source |    | GCTGGACAATTTTACAGCTGA |