Number of motifs Number of conditions Number of seed genes Number of extended seed genes Correlation extended seed No. (putative) regulators in module | = = = = = = | 1 77 4 4 0.96087 0 | [View full size image] | [View full size image] |
Motif | Motif logo | Module motif logo |
---|---|---|
LexA: Represses a number of genes involved in the response to DNA damage |
Gene | Seed/Extended Seed | Description | Direct interaction (RegulonDB) | Indirect interaction (RegulonDB) | Motif instance |
---|---|---|---|---|---|
b0231 (dinB) | Seed | DNA polymerase IV (Y-family DNA polymerase; translesion DNA synthesis) |    | ACTGTATACTTTACCAGTGTT | |
b3832 (rmuC) | Seed | putative alpha-helix chain |    | ACTGGACGTTTGTACAGCACA | |
b3645 (dinD) | Seed | DNA-damage-inducible protein |    | ACTGTATATAAATACAGTTAC | |
b0779 (uvrB) | Seed | DNA repair; excision nuclease subunit B | LexA | - | ACTGTTTTTTTATCCAGTATA |