Number of motifs Number of conditions Number of seed genes Number of extended seed genes Correlation extended seed No. (putative) regulators in module | = = = = = = | 1 85 4 4 0.92921 1 | ![]() [View full size image] | ![]() [View full size image] |
Motif | Motif logo | Module motif logo |
---|---|---|
LexA: Represses a number of genes involved in the response to DNA damage | ![]() | ![]() |
Gene | Seed/Extended Seed | Description | Direct interaction (RegulonDB) | Indirect interaction (RegulonDB) | Motif instance |
---|---|---|---|---|---|
b1061 (dinI) | Seed | DNA damage-inducible protein I |    | CCTGTATAAATAACCAGTATA | |
b3065 (rpsU) | Seed | 30S ribosomal subunit protein S21 | LexA | - | GCTGGCGTTGATGCCAGCGGC |
b1861 (ruvA) | Seed | branch migration of Holliday structures; repair | LexA | - | GCTGGATATCTATCCAGCATT |
b4043 (lexA) | Seed | LexA | LexA | - | GCTGTATATACTCACAGCATA |