Number of motifs Number of conditions Number of seed genes Number of extended seed genes Correlation extended seed No. (putative) regulators in module | = = = = = = | 1 39 4 4 0.93983 0 | [View full size image] | [View full size image] |
Motif | Motif logo | Module motif logo |
---|---|---|
NagC: transcriptional repressor of nag (N-acetylglucosamine) operon |
Gene | Seed/Extended Seed | Description | Direct interaction (RegulonDB) | Indirect interaction (RegulonDB) | Motif instance |
---|---|---|---|---|---|
b1266 (trpH) | Seed | conserved protein |    | CCTTGAGCGACACGAATTATGCAG | |
b1654 (grxD) | Seed | glutaredoxin 4 |    | CTTTTATTGTTAAAAAATACGTTT | |
b0191 (yaeJ) | Seed | conserved protein |    | TATCGGATGATAAGAATAATCTGG | |
b2987 (pitB) | Seed | phosphate transporter |    | TTTTTATCGTTAAAAAATGATATT |