Number of conditions
Number of seed genes
Number of extended seed genes
Correlation extended seed
No. (putative) regulators in module
=
=
=
=
=
39
4
4
0.93983
0
[View full size image]
![[View full size image]](./ExpressionProfiles/ExpressionProfile_seed_module_60.png){kind=link}
[View full size image]
| Number of motifs Number of conditions Number of seed genes Number of extended seed genes Correlation extended seed No. (putative) regulators in module | = = = = = = | 1 39 4 4 0.93983 0 | [View full size image] | [View full size image] |
| Motif | Motif logo | Module motif logo |
|---|---|---|
| NagC: transcriptional repressor of nag (N-acetylglucosamine) operon |  |  |
| Gene | Seed/Extended Seed | Description | Direct interaction (RegulonDB) | Indirect interaction (RegulonDB) | Motif instance |
|---|---|---|---|---|---|
| b1266 (trpH) | Seed | conserved protein | | CCTTGAGCGACACGAATTATGCAG | |
| b1654 (grxD) | Seed | glutaredoxin 4 | | CTTTTATTGTTAAAAAATACGTTT | |
| b0191 (yaeJ) | Seed | conserved protein | | TATCGGATGATAAGAATAATCTGG | |
| b2987 (pitB) | Seed | phosphate transporter | | TTTTTATCGTTAAAAAATGATATT |
![[View full size image]](./ExpressionProfiles/ExpressionProfile_extend_module_60.png){kind=link}