Number of motifs Number of conditions Number of seed genes Number of extended seed genes Correlation extended seed No. (putative) regulators in module | = = = = = = | 1 77 4 4 0.93746 0 | [View full size image] | [View full size image] |
Motif | Motif logo | Module motif logo |
---|---|---|
NagC: transcriptional repressor of nag (N-acetylglucosamine) operon |
Gene | Seed/Extended Seed | Description | Direct interaction (RegulonDB) | Indirect interaction (RegulonDB) | Motif instance |
---|---|---|---|---|---|
b2443 (yffL) | Seed | CPZ-55 prophage; predicted protein |    | TATTCCATTATTCCAATTAAGTGG | |
b2846 (yqeH) | Seed | conserved protein with bipartite regulator domain |    | TATTTGATAACGAGAAATGCATTT | |
b3717 (cbrC) | Seed | conserved protein |    | GTTTCTATGACTCAAAATATCAGG | |
b4311 (nanC) | Seed | N-acetylneuraminic acid outer membrane channel |    | - | TATTTCATGATGAGAATTATGCTC |