Number of conditions
Number of seed genes
Number of extended seed genes
Correlation extended seed
No. (putative) regulators in module
=
=
=
=
=
77
4
4
0.93746
0
[View full size image]
![[View full size image]](./ExpressionProfiles/ExpressionProfile_seed_module_59.png){kind=link}
[View full size image]
| Number of motifs Number of conditions Number of seed genes Number of extended seed genes Correlation extended seed No. (putative) regulators in module | = = = = = = | 1 77 4 4 0.93746 0 | [View full size image] | [View full size image] |
| Motif | Motif logo | Module motif logo |
|---|---|---|
| NagC: transcriptional repressor of nag (N-acetylglucosamine) operon |  |  |
| Gene | Seed/Extended Seed | Description | Direct interaction (RegulonDB) | Indirect interaction (RegulonDB) | Motif instance |
|---|---|---|---|---|---|
| b2443 (yffL) | Seed | CPZ-55 prophage; predicted protein | | TATTCCATTATTCCAATTAAGTGG | |
| b2846 (yqeH) | Seed | conserved protein with bipartite regulator domain | | TATTTGATAACGAGAAATGCATTT | |
| b3717 (cbrC) | Seed | conserved protein | | GTTTCTATGACTCAAAATATCAGG | |
| b4311 (nanC) | Seed | N-acetylneuraminic acid outer membrane channel | | - | TATTTCATGATGAGAATTATGCTC |
![[View full size image]](./ExpressionProfiles/ExpressionProfile_extend_module_59.png){kind=link}