Number of conditions
Number of seed genes
Number of extended seed genes
Correlation extended seed
No. (putative) regulators in module
=
=
=
=
=
106
4
4
0.93976
0
[View full size image]
![[View full size image]](./ExpressionProfiles/ExpressionProfile_seed_module_58.png){kind=link}
[View full size image]
| Number of motifs Number of conditions Number of seed genes Number of extended seed genes Correlation extended seed No. (putative) regulators in module | = = = = = = | 1 106 4 4 0.93976 0 | [View full size image] | [View full size image] |
| Motif | Motif logo | Module motif logo |
|---|---|---|
| NagC: transcriptional repressor of nag (N-acetylglucosamine) operon |  |  |
| Gene | Seed/Extended Seed | Description | Direct interaction (RegulonDB) | Indirect interaction (RegulonDB) | Motif instance |
|---|---|---|---|---|---|
| b3688 (yidQ) | Seed | conserved outer membrane protein | | TTTATTATGATAAGAAATGTGTTG | |
| b0394 (mak) | Seed | b0394 | | CTATTGATATTGAAAAAAATAAGG | |
| b2112 (yehE) | Seed | predicted protein | | TATTTAATACTGCGAATATTCTGC | |
| b3746 (ravA) | Seed | regulatory ATPase | | TTATTAGCGGAAAGAATTTCCCGC |
![[View full size image]](./ExpressionProfiles/ExpressionProfile_extend_module_58.png){kind=link}