Number of motifs Number of conditions Number of seed genes Number of extended seed genes Correlation extended seed No. (putative) regulators in module | = = = = = = | 1 106 4 4 0.93976 0 | [View full size image] | [View full size image] |
Motif | Motif logo | Module motif logo |
---|---|---|
NagC: transcriptional repressor of nag (N-acetylglucosamine) operon |
Gene | Seed/Extended Seed | Description | Direct interaction (RegulonDB) | Indirect interaction (RegulonDB) | Motif instance |
---|---|---|---|---|---|
b3688 (yidQ) | Seed | conserved outer membrane protein |    | TTTATTATGATAAGAAATGTGTTG | |
b0394 (mak) | Seed | b0394 |    | CTATTGATATTGAAAAAAATAAGG | |
b2112 (yehE) | Seed | predicted protein |    | TATTTAATACTGCGAATATTCTGC | |
b3746 (ravA) | Seed | regulatory ATPase |    | TTATTAGCGGAAAGAATTTCCCGC |