Number of conditions
Number of seed genes
Number of extended seed genes
Correlation extended seed
No. (putative) regulators in module
=
=
=
=
=
51
4
4
0.93328
0
[View full size image]
![[View full size image]](./ExpressionProfiles/ExpressionProfile_seed_module_57.png){kind=link}
[View full size image]
| Number of motifs Number of conditions Number of seed genes Number of extended seed genes Correlation extended seed No. (putative) regulators in module | = = = = = = | 1 51 4 4 0.93328 0 | [View full size image] | [View full size image] |
| Motif | Motif logo | Module motif logo |
|---|---|---|
| NagC: transcriptional repressor of nag (N-acetylglucosamine) operon |  |  |
| Gene | Seed/Extended Seed | Description | Direct interaction (RegulonDB) | Indirect interaction (RegulonDB) | Motif instance |
|---|---|---|---|---|---|
| b2774 (ygcW) | Seed | predicted deoxygluconate dehydrogenase | | TATTTGACAATACGAATATCACAC | |
| b0681 (ybfM) | Seed | predicted outer membrane porin | | TAATTCGCGTCGCGAAAAATAGTC | |
| b3411 (yhgA) | Seed | predicted transposase | NagC | CATCTCGCAGGGATGAAAACTCGC | |
| b3427 () | Seed | b3427 | | AATTTCACCATTCAAAAAGAATGG |
![[View full size image]](./ExpressionProfiles/ExpressionProfile_extend_module_57.png){kind=link}