Number of motifs Number of conditions Number of seed genes Number of extended seed genes Correlation extended seed No. (putative) regulators in module | = = = = = = | 1 51 4 4 0.93328 0 | [View full size image] | [View full size image] |
Motif | Motif logo | Module motif logo |
---|---|---|
NagC: transcriptional repressor of nag (N-acetylglucosamine) operon |
Gene | Seed/Extended Seed | Description | Direct interaction (RegulonDB) | Indirect interaction (RegulonDB) | Motif instance |
---|---|---|---|---|---|
b2774 (ygcW) | Seed | predicted deoxygluconate dehydrogenase |    | TATTTGACAATACGAATATCACAC | |
b0681 (ybfM) | Seed | predicted outer membrane porin |    | TAATTCGCGTCGCGAAAAATAGTC | |
b3411 (yhgA) | Seed | predicted transposase | NagC | CATCTCGCAGGGATGAAAACTCGC | |
b3427 () | Seed | b3427 |    | AATTTCACCATTCAAAAAGAATGG |