Number of motifs Number of conditions Number of seed genes Number of extended seed genes Correlation extended seed No. (putative) regulators in module | = = = = = = | 1 41 4 4 0.96394 0 | [View full size image] | [View full size image] |
Motif | Motif logo | Module motif logo |
---|---|---|
NsrR: |
Gene | Seed/Extended Seed | Description | Direct interaction (RegulonDB) | Indirect interaction (RegulonDB) | Motif instance |
---|---|---|---|---|---|
b2732 (ygbA) | Seed | predicted protein | NsrR | - | TAAGATGTAATATAAATACATCTT |
b1426 (ydcH) | Seed | conserved hypothetical protein |    | TGGTGTGTATTTCAGATACACCTT | |
b4209 (ytfE) | Seed | protein involved in repair of stress-damaged iron-sulfur clusters | NsrR | - | AAAGATGCATTTAAAATACATCTT |
b2552 (hmp) | Seed | b2552 | NsrR | - | TAAGATGCATTTGAGATACATCAA |