Number of conditions
Number of seed genes
Number of extended seed genes
Correlation extended seed
No. (putative) regulators in module
=
=
=
=
=
41
4
4
0.96394
0
[View full size image]
![[View full size image]](./ExpressionProfiles/ExpressionProfile_seed_module_51.png){kind=link}
[View full size image]
| Number of motifs Number of conditions Number of seed genes Number of extended seed genes Correlation extended seed No. (putative) regulators in module | = = = = = = | 1 41 4 4 0.96394 0 | [View full size image] | [View full size image] |
| Motif | Motif logo | Module motif logo |
|---|---|---|
| NsrR: |  |  |
| Gene | Seed/Extended Seed | Description | Direct interaction (RegulonDB) | Indirect interaction (RegulonDB) | Motif instance |
|---|---|---|---|---|---|
| b2732 (ygbA) | Seed | predicted protein | NsrR | - | TAAGATGTAATATAAATACATCTT |
| b1426 (ydcH) | Seed | conserved hypothetical protein | | TGGTGTGTATTTCAGATACACCTT | |
| b4209 (ytfE) | Seed | protein involved in repair of stress-damaged iron-sulfur clusters | NsrR | - | AAAGATGCATTTAAAATACATCTT |
| b2552 (hmp) | Seed | b2552 | NsrR | - | TAAGATGCATTTGAGATACATCAA |
![[View full size image]](./ExpressionProfiles/ExpressionProfile_extend_module_51.png){kind=link}