Number of motifs Number of conditions Number of seed genes Number of extended seed genes Correlation extended seed No. (putative) regulators in module | = = = = = = | 1 95 4 4 0.93225 1 | [View full size image] | [View full size image] |
Motif | Motif logo | Module motif logo |
---|---|---|
IscR: Fe-S cluster-containing transcription factor transcriptional repressor of iscRSUA operon |
Gene | Seed/Extended Seed | Description | Direct interaction (RegulonDB) | Indirect interaction (RegulonDB) | Motif instance |
---|---|---|---|---|---|
b3414 (gntY) | Seed | protein involved in utilization of DNA as a carbon source | IscR | - | TATAACCAACTAAAATAGTCAACTAT |
b2531 (iscR) | Seed | IscR transcriptional dual regulator | IscR | - | AATAGTTGACCAATTTACTCGGGAAT |
b1684 (sufA) | Seed | Fe-S cluster assembly protein | IscR | + | TAAAGCCCCTGCGTTTGCTGGGTTGA |
b1706 (ydiU) | Seed | conserved protein | IscR | + | GATAACCCTTCTGTTTGCTGGTGTTT |