Number of conditions
Number of seed genes
Number of extended seed genes
Correlation extended seed
No. (putative) regulators in module
=
=
=
=
=
95
4
4
0.93225
1
[View full size image]
![[View full size image]](./ExpressionProfiles/ExpressionProfile_seed_module_48.png){kind=link}
[View full size image]
| Number of motifs Number of conditions Number of seed genes Number of extended seed genes Correlation extended seed No. (putative) regulators in module | = = = = = = | 1 95 4 4 0.93225 1 | [View full size image] | [View full size image] |
| Motif | Motif logo | Module motif logo |
|---|---|---|
| IscR: Fe-S cluster-containing transcription factor transcriptional repressor of iscRSUA operon |  |  |
| Gene | Seed/Extended Seed | Description | Direct interaction (RegulonDB) | Indirect interaction (RegulonDB) | Motif instance |
|---|---|---|---|---|---|
| b3414 (gntY) | Seed | protein involved in utilization of DNA as a carbon source | IscR | - | TATAACCAACTAAAATAGTCAACTAT |
| b2531 (iscR) | Seed | IscR transcriptional dual regulator | IscR | - | AATAGTTGACCAATTTACTCGGGAAT |
| b1684 (sufA) | Seed | Fe-S cluster assembly protein | IscR | + | TAAAGCCCCTGCGTTTGCTGGGTTGA |
| b1706 (ydiU) | Seed | conserved protein | IscR | + | GATAACCCTTCTGTTTGCTGGTGTTT |
![[View full size image]](./ExpressionProfiles/ExpressionProfile_extend_module_48.png){kind=link}