Number of conditions
Number of seed genes
Number of extended seed genes
Correlation extended seed
No. (putative) regulators in module
=
=
=
=
=
89
4
4
0.92839
1
[View full size image]
![[View full size image]](./ExpressionProfiles/ExpressionProfile_seed_module_47.png){kind=link}
[View full size image]
| Number of motifs Number of conditions Number of seed genes Number of extended seed genes Correlation extended seed No. (putative) regulators in module | = = = = = = | 1 89 4 4 0.92839 1 | [View full size image] | [View full size image] |
| Motif | Motif logo | Module motif logo |
|---|---|---|
| OmpR: part of two-component system EnvZ/OmpR; regulates transcription of outer membrane porin genes ompC/F; under high osmolarity EnvZ functions as kinase/phosphotransferase and phosphorylates OmpR; the result is increased expression of ompC and repression of om |  |  |
| Gene | Seed/Extended Seed | Description | Direct interaction (RegulonDB) | Indirect interaction (RegulonDB) | Motif instance |
|---|---|---|---|---|---|
| b1892 (flhD) | Seed | FlhD | OmpR | - | GATTTAGGAAAAATCTTAGAT |
| b0553 (nmpC) | Seed | outer membrane porin protein; locus of qsr prophage | OmpR | - | GAAACCAAAACTTACATCTTG |
| b0598 (cstA) | Seed | peptide transporter induced by carbon starvation | | GAAACAAAATGTAACATCTCT | |
| b0811 (glnH) | Seed | GlnH | | GTTACATAAAGATTGTTTTTT |
![[View full size image]](./ExpressionProfiles/ExpressionProfile_extend_module_47.png){kind=link}