Number of motifs Number of conditions Number of seed genes Number of extended seed genes Correlation extended seed No. (putative) regulators in module | = = = = = = | 1 89 4 4 0.92839 1 | [View full size image] | [View full size image] |
Motif | Motif logo | Module motif logo |
---|---|---|
OmpR: part of two-component system EnvZ/OmpR; regulates transcription of outer membrane porin genes ompC/F; under high osmolarity EnvZ functions as kinase/phosphotransferase and phosphorylates OmpR; the result is increased expression of ompC and repression of om |
Gene | Seed/Extended Seed | Description | Direct interaction (RegulonDB) | Indirect interaction (RegulonDB) | Motif instance |
---|---|---|---|---|---|
b1892 (flhD) | Seed | FlhD | OmpR | - | GATTTAGGAAAAATCTTAGAT |
b0553 (nmpC) | Seed | outer membrane porin protein; locus of qsr prophage | OmpR | - | GAAACCAAAACTTACATCTTG |
b0598 (cstA) | Seed | peptide transporter induced by carbon starvation |    | GAAACAAAATGTAACATCTCT | |
b0811 (glnH) | Seed | GlnH |    | GTTACATAAAGATTGTTTTTT |