Number of motifs Number of conditions Number of seed genes Number of extended seed genes Correlation extended seed No. (putative) regulators in module | = = = = = = | 1 40 5 5 0.95396 0 | ![]() [View full size image] | ![]() [View full size image] |
Motif | Motif logo | Module motif logo |
---|---|---|
PhoB: positive response regulator for pho regulon, sensor is PhoR (or CreC) | ![]() | ![]() |
Gene | Seed/Extended Seed | Description | Direct interaction (RegulonDB) | Indirect interaction (RegulonDB) | Motif instance |
---|---|---|---|---|---|
b3211 (yhcC) | Seed | predicted Fe-S oxidoreductase |    | ACTGTCATAAAGGTGTGTTAA | |
b2884 () | Seed | b2884 |    | ||
b4464 (ygfQ) | Seed | predicted transporter |    | CTAATAATAAAACTTTAACAT | |
b3728 (pstS) | Seed | PstS | PhoB | + | TCTGTCATAAAACTGTCATAT |
b2720 (hycF) | Seed | formate hydrogenlyase complex iron-sulfur protein |    | CCTTTATCAAAAAAGTCATCA |