Number of motifs Number of conditions Number of seed genes Number of extended seed genes Correlation extended seed No. (putative) regulators in module | = = = = = = | 1 107 4 4 0.94585 0 | [View full size image] | [View full size image] |
Motif | Motif logo | Module motif logo |
---|---|---|
TyrR: transcriptional regulation of aroF, aroG, tyrA and aromatic amino acid transport |
Gene | Seed/Extended Seed | Description | Direct interaction (RegulonDB) | Indirect interaction (RegulonDB) | Motif instance |
---|---|---|---|---|---|
b0754 (aroG) | Seed | AroG | TyrR | - | TAGTGTAAAACCCCGTTTACACA |
b0112 (aroP) | Seed | AroP phenylalanine/tyrosine/tryptophan APC transporter | TyrR | - | TGATGTAAACAAATTAATACAAC |
b2601 (aroF) | Seed | AroF | TyrR | - | GAGTGTAAATTTATCTATACAGA |
b0406 (tgt) | Seed | tRNA-guanine transglycosylase monomer |    | AAATGAAATTTGAACTGGACACC |