Number of motifs Number of conditions Number of seed genes Number of extended seed genes Correlation extended seed No. (putative) regulators in module | = = = = = = | 1 100 4 4 0.91337 1 | [View full size image] | [View full size image] |
Motif | Motif logo | Module motif logo |
---|---|---|
GadE: orf, hypothetical protein |
Gene | Seed/Extended Seed | Description | Direct interaction (RegulonDB) | Indirect interaction (RegulonDB) | Motif instance |
---|---|---|---|---|---|
b3490 () | Seed | b3490 |    | CTTATGCTGTTGTTTTTTACA | |
b3512 (gadE) | Seed | GadE transcriptional activator | GadE | + | ACTTTTTGTTTGCTATTTACA |
b4326 (yjiD) | Seed | hypothetical protein |    | AATTTGATGTTGCTATATTGA | |
b3517 (gadA) | Seed | glutamate decarboxylase A subunit | GadE | + | CTTAGGATTTTGTTATTTAAA |