Number of conditions
Number of seed genes
Number of extended seed genes
Correlation extended seed
No. (putative) regulators in module
=
=
=
=
=
100
4
4
0.91337
1
[View full size image]
![[View full size image]](./ExpressionProfiles/ExpressionProfile_seed_module_40.png){kind=link}
[View full size image]
| Number of motifs Number of conditions Number of seed genes Number of extended seed genes Correlation extended seed No. (putative) regulators in module | = = = = = = | 1 100 4 4 0.91337 1 | [View full size image] | [View full size image] |
| Motif | Motif logo | Module motif logo |
|---|---|---|
| GadE: orf, hypothetical protein |  |  |
| Gene | Seed/Extended Seed | Description | Direct interaction (RegulonDB) | Indirect interaction (RegulonDB) | Motif instance |
|---|---|---|---|---|---|
| b3490 () | Seed | b3490 | | CTTATGCTGTTGTTTTTTACA | |
| b3512 (gadE) | Seed | GadE transcriptional activator | GadE | + | ACTTTTTGTTTGCTATTTACA |
| b4326 (yjiD) | Seed | hypothetical protein | | AATTTGATGTTGCTATATTGA | |
| b3517 (gadA) | Seed | glutamate decarboxylase A subunit | GadE | + | CTTAGGATTTTGTTATTTAAA |
![[View full size image]](./ExpressionProfiles/ExpressionProfile_extend_module_40.png){kind=link}