Number of motifs Number of conditions Number of seed genes Number of extended seed genes Correlation extended seed No. (putative) regulators in module | = = = = = = | 1 81 4 5 0.90861 0 | ![]() [View full size image] | ![]() [View full size image] |
Motif | Motif logo | Module motif logo |
---|---|---|
MarA: multiple antibiotic resistance; transcriptional activator of defense systems | ![]() | ![]() |
Gene | Seed/Extended Seed | Description | Direct interaction (RegulonDB) | Indirect interaction (RegulonDB) | Motif instance |
---|---|---|---|---|---|
b4107 (yjdN) | Seed | conserved protein |    | GGCAACAGTGCCAACTGCCTGA | |
b4177 (purA) | Seed | PurA | MarA | - | GCAAAAAGTGCTGTAACTCTGA |
b3506 (slp) | Seed | starvation lipoprotein | MarA | - | ACAAAAGGTGCACTCATCCTCA |
b3510 (hdeA) | Seed | acid-resistance protein, possible chaperone | MarA | - | TCAATCTATGCCAAAAACGCGT |
b3509 (hdeB) | Extension | acid stress chaperone |    | - |    |