Number of motifs Number of conditions Number of seed genes Number of extended seed genes Correlation extended seed No. (putative) regulators in module | = = = = = = | 1 55 5 5 0.95474 0 | [View full size image] | [View full size image] |
Motif | Motif logo | Module motif logo |
---|---|---|
LexA: Represses a number of genes involved in the response to DNA damage |
Gene | Seed/Extended Seed | Description | Direct interaction (RegulonDB) | Indirect interaction (RegulonDB) | Motif instance |
---|---|---|---|---|---|
b0958 (sulA) | Seed | SOS cell division inhibitor | LexA | - | ACTGTACATCCATACAGTAAC |
b0799 (dinG) | Seed | ATP-dependent helicase | LexA | - | ATTGGCTGTTTATACAGTATT |
b2699 (recA) | Seed | DNA strand exchange and recombination protein with protease and nuclease activity | LexA | - | ACTGTATGAGCATACAGTATA |
b1848 (yebG) | Seed | conserved protein regulated by LexA |    | ACTGTATAAAATCACAGTTAT | |
b2616 (recN) | Seed | protein used in recombination and DNA repair | LexA | - | ACTGTATATAAAACCAGTTTA |