Number of conditions
Number of seed genes
Number of extended seed genes
Correlation extended seed
No. (putative) regulators in module
=
=
=
=
=
55
5
5
0.95474
0
[View full size image]
![[View full size image]](./ExpressionProfiles/ExpressionProfile_seed_module_33.png){kind=link}
[View full size image]
| Number of motifs Number of conditions Number of seed genes Number of extended seed genes Correlation extended seed No. (putative) regulators in module | = = = = = = | 1 55 5 5 0.95474 0 | [View full size image] | [View full size image] |
| Motif | Motif logo | Module motif logo |
|---|---|---|
| LexA: Represses a number of genes involved in the response to DNA damage |  |  |
| Gene | Seed/Extended Seed | Description | Direct interaction (RegulonDB) | Indirect interaction (RegulonDB) | Motif instance |
|---|---|---|---|---|---|
| b0958 (sulA) | Seed | SOS cell division inhibitor | LexA | - | ACTGTACATCCATACAGTAAC |
| b0799 (dinG) | Seed | ATP-dependent helicase | LexA | - | ATTGGCTGTTTATACAGTATT |
| b2699 (recA) | Seed | DNA strand exchange and recombination protein with protease and nuclease activity | LexA | - | ACTGTATGAGCATACAGTATA |
| b1848 (yebG) | Seed | conserved protein regulated by LexA | | ACTGTATAAAATCACAGTTAT | |
| b2616 (recN) | Seed | protein used in recombination and DNA repair | LexA | - | ACTGTATATAAAACCAGTTTA |
![[View full size image]](./ExpressionProfiles/ExpressionProfile_extend_module_33.png){kind=link}