Number of conditions
Number of seed genes
Number of extended seed genes
Correlation extended seed
No. (putative) regulators in module
=
=
=
=
=
79
4
4
0.93515
0
[View full size image]
![[View full size image]](./ExpressionProfiles/ExpressionProfile_seed_module_31.png){kind=link}
[View full size image]
| Number of motifs Number of conditions Number of seed genes Number of extended seed genes Correlation extended seed No. (putative) regulators in module | = = = = = = | 1 79 4 4 0.93515 0 | [View full size image] | [View full size image] |
| Motif | Motif logo | Module motif logo |
|---|---|---|
| CueR: NN |  |  |
| Gene | Seed/Extended Seed | Description | Direct interaction (RegulonDB) | Indirect interaction (RegulonDB) | Motif instance |
|---|---|---|---|---|---|
| b0781 (moaA) | Seed | molybdopterin biosynthesis, protein A | CueR | - | CGCCTCCCGTATCTGGAAAG |
| b0123 (cueO) | Seed | multicopper oxidase with role in copper homeostasis | CueR | + | ACCTTCCCGTAAGGGGAAGG |
| b0484 (copA) | Seed | Cu+-exporting ATPase | CueR | + | ACCTTCCCCTTGCTGGAAGG |
| b0209 (yafD) | Seed | conserved protein | | ACCCTCCCGAGTGCGGAAGG |
![[View full size image]](./ExpressionProfiles/ExpressionProfile_extend_module_31.png){kind=link}