Number of motifs Number of conditions Number of seed genes Number of extended seed genes Correlation extended seed No. (putative) regulators in module | = = = = = = | 1 79 4 4 0.93515 0 | [View full size image] | [View full size image] |
Motif | Motif logo | Module motif logo |
---|---|---|
CueR: NN |
Gene | Seed/Extended Seed | Description | Direct interaction (RegulonDB) | Indirect interaction (RegulonDB) | Motif instance |
---|---|---|---|---|---|
b0781 (moaA) | Seed | molybdopterin biosynthesis, protein A | CueR | - | CGCCTCCCGTATCTGGAAAG |
b0123 (cueO) | Seed | multicopper oxidase with role in copper homeostasis | CueR | + | ACCTTCCCGTAAGGGGAAGG |
b0484 (copA) | Seed | Cu+-exporting ATPase | CueR | + | ACCTTCCCCTTGCTGGAAGG |
b0209 (yafD) | Seed | conserved protein |    | ACCCTCCCGAGTGCGGAAGG |