Number of conditions
Number of seed genes
Number of extended seed genes
Correlation extended seed
No. (putative) regulators in module
=
=
=
=
=
87
4
4
0.93724
0
[View full size image]
![[View full size image]](./ExpressionProfiles/ExpressionProfile_seed_module_150.png){kind=link}
[View full size image]
| Number of motifs Number of conditions Number of seed genes Number of extended seed genes Correlation extended seed No. (putative) regulators in module | = = = = = = | 1 87 4 4 0.93724 0 | [View full size image] | [View full size image] |
| Motif | Motif logo | Module motif logo |
|---|---|---|
| CRP: cyclic AMP receptor protein |  |  |
| Gene | Seed/Extended Seed | Description | Direct interaction (RegulonDB) | Indirect interaction (RegulonDB) | Motif instance |
|---|---|---|---|---|---|
| b4268 (idnK) | Seed | gluconokinase II | CRP | + | ATTTGTGATGAAGATCACGTCAG |
| b4322 (uxuA) | Seed | b4322 | CRP | + | TGTTGCGATGAATGTCACATCCT |
| b4195 (ulaC) | Seed | UlaC | CRP | + | ACTGCTGGAAGTGATCAAAGAGC |
| b3707 (tnaC) | Seed | tna operon leader peptide | CRP | + | GATTGTGATTCGATTCACATTTA |
![[View full size image]](./ExpressionProfiles/ExpressionProfile_extend_module_150.png){kind=link}