Number of motifs Number of conditions Number of seed genes Number of extended seed genes Correlation extended seed No. (putative) regulators in module | = = = = = = | 1 87 4 4 0.93724 0 | [View full size image] | [View full size image] |
Motif | Motif logo | Module motif logo |
---|---|---|
CRP: cyclic AMP receptor protein |
Gene | Seed/Extended Seed | Description | Direct interaction (RegulonDB) | Indirect interaction (RegulonDB) | Motif instance |
---|---|---|---|---|---|
b4268 (idnK) | Seed | gluconokinase II | CRP | + | ATTTGTGATGAAGATCACGTCAG |
b4322 (uxuA) | Seed | b4322 | CRP | + | TGTTGCGATGAATGTCACATCCT |
b4195 (ulaC) | Seed | UlaC | CRP | + | ACTGCTGGAAGTGATCAAAGAGC |
b3707 (tnaC) | Seed | tna operon leader peptide | CRP | + | GATTGTGATTCGATTCACATTTA |