Number of motifs Number of conditions Number of seed genes Number of extended seed genes Correlation extended seed No. (putative) regulators in module | = = = = = = | 1 39 4 4 0.96084 1 | [View full size image] | [View full size image] |
Motif | Motif logo | Module motif logo |
---|---|---|
CRP: cyclic AMP receptor protein |
Gene | Seed/Extended Seed | Description | Direct interaction (RegulonDB) | Indirect interaction (RegulonDB) | Motif instance |
---|---|---|---|---|---|
b3909 (kdgT) | Seed | 2-dehydro-3-deoxy-D-gluconate transporter |    | TTTTGTGATCAATTTCAAAATAA | |
b3575 (yiaK) | Seed | 2,3-diketo-L-gulonate reductase monomer | CRP | +- | AAGTGTGCCGTAGTTCACGATCT |
b3905 (rhaS) | Seed | RhaS | CRP | + | GAACGTGATGATGTTCACAATTT |
b1138 (ymfE) | Seed | hypothetical protein |    | ATACGTGCTACTGATCACAATAT |