Number of conditions
Number of seed genes
Number of extended seed genes
Correlation extended seed
No. (putative) regulators in module
=
=
=
=
=
39
4
4
0.96084
1
[View full size image]
![[View full size image]](./ExpressionProfiles/ExpressionProfile_seed_module_149.png){kind=link}
[View full size image]
| Number of motifs Number of conditions Number of seed genes Number of extended seed genes Correlation extended seed No. (putative) regulators in module | = = = = = = | 1 39 4 4 0.96084 1 | [View full size image] | [View full size image] |
| Motif | Motif logo | Module motif logo |
|---|---|---|
| CRP: cyclic AMP receptor protein |  |  |
| Gene | Seed/Extended Seed | Description | Direct interaction (RegulonDB) | Indirect interaction (RegulonDB) | Motif instance |
|---|---|---|---|---|---|
| b3909 (kdgT) | Seed | 2-dehydro-3-deoxy-D-gluconate transporter | | TTTTGTGATCAATTTCAAAATAA | |
| b3575 (yiaK) | Seed | 2,3-diketo-L-gulonate reductase monomer | CRP | +- | AAGTGTGCCGTAGTTCACGATCT |
| b3905 (rhaS) | Seed | RhaS | CRP | + | GAACGTGATGATGTTCACAATTT |
| b1138 (ymfE) | Seed | hypothetical protein | | ATACGTGCTACTGATCACAATAT |
![[View full size image]](./ExpressionProfiles/ExpressionProfile_extend_module_149.png){kind=link}