Number of conditions
Number of seed genes
Number of extended seed genes
Correlation extended seed
No. (putative) regulators in module
=
=
=
=
=
78
4
5
0.90828
0
[View full size image]
![[View full size image]](./ExpressionProfiles/ExpressionProfile_seed_module_148.png){kind=link}
[View full size image]
| Number of motifs Number of conditions Number of seed genes Number of extended seed genes Correlation extended seed No. (putative) regulators in module | = = = = = = | 1 78 4 5 0.90828 0 | [View full size image] | [View full size image] |
| Motif | Motif logo | Module motif logo |
|---|---|---|
| CRP: cyclic AMP receptor protein |  |  |
| Gene | Seed/Extended Seed | Description | Direct interaction (RegulonDB) | Indirect interaction (RegulonDB) | Motif instance |
|---|---|---|---|---|---|
| b2509 (xseA) | Seed | exonuclease VII, large subunit | CRP | - | GAATTTGATCTCGCTCACATGTT |
| b1255 (yciC) | Seed | predicted inner membrane protein | | TAATGTGATTTAAATCAATTTTT | |
| b3238 (yhcN) | Seed | conserved protein | | TTTTGTGATATGGGTCACGAAAC | |
| b2508 (guaB) | Seed | GuaB | CRP | + | ACGTTTGACGACGTTCTCCTCGT |
| b2507 (guaA) | Extension | GMP synthetase | | + | |
![[View full size image]](./ExpressionProfiles/ExpressionProfile_extend_module_148.png){kind=link}