Number of motifs Number of conditions Number of seed genes Number of extended seed genes Correlation extended seed No. (putative) regulators in module | = = = = = = | 1 78 4 5 0.90828 0 | [View full size image] | [View full size image] |
Motif | Motif logo | Module motif logo |
---|---|---|
CRP: cyclic AMP receptor protein |
Gene | Seed/Extended Seed | Description | Direct interaction (RegulonDB) | Indirect interaction (RegulonDB) | Motif instance |
---|---|---|---|---|---|
b2509 (xseA) | Seed | exonuclease VII, large subunit | CRP | - | GAATTTGATCTCGCTCACATGTT |
b1255 (yciC) | Seed | predicted inner membrane protein |    | TAATGTGATTTAAATCAATTTTT | |
b3238 (yhcN) | Seed | conserved protein |    | TTTTGTGATATGGGTCACGAAAC | |
b2508 (guaB) | Seed | GuaB | CRP | + | ACGTTTGACGACGTTCTCCTCGT |
b2507 (guaA) | Extension | GMP synthetase |    | + |    |