Number of motifs Number of conditions Number of seed genes Number of extended seed genes Correlation extended seed No. (putative) regulators in module | = = = = = = | 1 59 4 4 0.9475 0 | [View full size image] | [View full size image] |
Motif | Motif logo | Module motif logo |
---|---|---|
CRP: cyclic AMP receptor protein |
Gene | Seed/Extended Seed | Description | Direct interaction (RegulonDB) | Indirect interaction (RegulonDB) | Motif instance |
---|---|---|---|---|---|
b4267 (idnD) | Seed | b4267 | CRP | + | TGACGTGATCTTCATCACAAATA |
b4208 (cycA) | Seed | CycA serine/alanine/glycine APC transporter |    | TTTTGTGAGCTGTTTCGCGTTAT | |
b2344 (fadL) | Seed | transport of long-chain fatty acids; sensitivity to phage T2 | CRP | - | ATAAGTGACCGAAATCACACTTA |
b1182 (hlyE) | Seed | hemolysin E | CRP | + | TTGTTTGATATTTATCATATTAA |