Number of conditions
Number of seed genes
Number of extended seed genes
Correlation extended seed
No. (putative) regulators in module
=
=
=
=
=
59
4
4
0.9475
0
[View full size image]
![[View full size image]](./ExpressionProfiles/ExpressionProfile_seed_module_147.png){kind=link}
[View full size image]
| Number of motifs Number of conditions Number of seed genes Number of extended seed genes Correlation extended seed No. (putative) regulators in module | = = = = = = | 1 59 4 4 0.9475 0 | [View full size image] | [View full size image] |
| Motif | Motif logo | Module motif logo |
|---|---|---|
| CRP: cyclic AMP receptor protein |  |  |
| Gene | Seed/Extended Seed | Description | Direct interaction (RegulonDB) | Indirect interaction (RegulonDB) | Motif instance |
|---|---|---|---|---|---|
| b4267 (idnD) | Seed | b4267 | CRP | + | TGACGTGATCTTCATCACAAATA |
| b4208 (cycA) | Seed | CycA serine/alanine/glycine APC transporter | | TTTTGTGAGCTGTTTCGCGTTAT | |
| b2344 (fadL) | Seed | transport of long-chain fatty acids; sensitivity to phage T2 | CRP | - | ATAAGTGACCGAAATCACACTTA |
| b1182 (hlyE) | Seed | hemolysin E | CRP | + | TTGTTTGATATTTATCATATTAA |
![[View full size image]](./ExpressionProfiles/ExpressionProfile_extend_module_147.png){kind=link}