Number of motifs Number of conditions Number of seed genes Number of extended seed genes Correlation extended seed No. (putative) regulators in module | = = = = = = | 1 36 4 4 0.94718 0 | [View full size image] | [View full size image] |
Motif | Motif logo | Module motif logo |
---|---|---|
CRP: cyclic AMP receptor protein |
Gene | Seed/Extended Seed | Description | Direct interaction (RegulonDB) | Indirect interaction (RegulonDB) | Motif instance |
---|---|---|---|---|---|
b2393 (nupC) | Seed | NupC nucleoside NUP transporter | CRP | + | TAGTGTGTGTCAGATCTCGTTTT |
b3356 (yhfA) | Seed | conserved protein | CRP | +- | TAATGTGACGTCCTTTGCATACA |
b2943 (galP) | Seed | GalP | CRP | + | TGATGTGATTTGCTTCACATCTT |
b3870 (glnA) | Seed | GlnA | CRP | +- | CTTTGTGATCGCTTTCACGGAGC |