Number of conditions
Number of seed genes
Number of extended seed genes
Correlation extended seed
No. (putative) regulators in module
=
=
=
=
=
36
4
4
0.94718
0
[View full size image]
![[View full size image]](./ExpressionProfiles/ExpressionProfile_seed_module_146.png){kind=link}
[View full size image]
| Number of motifs Number of conditions Number of seed genes Number of extended seed genes Correlation extended seed No. (putative) regulators in module | = = = = = = | 1 36 4 4 0.94718 0 | [View full size image] | [View full size image] |
| Motif | Motif logo | Module motif logo |
|---|---|---|
| CRP: cyclic AMP receptor protein |  |  |
| Gene | Seed/Extended Seed | Description | Direct interaction (RegulonDB) | Indirect interaction (RegulonDB) | Motif instance |
|---|---|---|---|---|---|
| b2393 (nupC) | Seed | NupC nucleoside NUP transporter | CRP | + | TAGTGTGTGTCAGATCTCGTTTT |
| b3356 (yhfA) | Seed | conserved protein | CRP | +- | TAATGTGACGTCCTTTGCATACA |
| b2943 (galP) | Seed | GalP | CRP | + | TGATGTGATTTGCTTCACATCTT |
| b3870 (glnA) | Seed | GlnA | CRP | +- | CTTTGTGATCGCTTTCACGGAGC |
![[View full size image]](./ExpressionProfiles/ExpressionProfile_extend_module_146.png){kind=link}