Number of conditions
Number of seed genes
Number of extended seed genes
Correlation extended seed
No. (putative) regulators in module
=
=
=
=
=
36
4
4
0.95322
0
[View full size image]
![[View full size image]](./ExpressionProfiles/ExpressionProfile_seed_module_145.png){kind=link}
[View full size image]
| Number of motifs Number of conditions Number of seed genes Number of extended seed genes Correlation extended seed No. (putative) regulators in module | = = = = = = | 1 36 4 4 0.95322 0 | [View full size image] | [View full size image] |
| Motif | Motif logo | Module motif logo |
|---|---|---|
| CRP: cyclic AMP receptor protein |  |  |
| Gene | Seed/Extended Seed | Description | Direct interaction (RegulonDB) | Indirect interaction (RegulonDB) | Motif instance |
|---|---|---|---|---|---|
| b1188 (ycgB) | Seed | putative sporulation protein | | TATGGTGAGCTGGCTCACATCTC | |
| b0957 (ompA) | Seed | outer membrane protein 3a (II*;G;d) | CRP | + | ATGCCTGACGGAGTTCACACTTG |
| b0459 (maa) | Seed | Maa | | CTATGTGATCTTTATCACACAGA | |
| b0331 (prpB) | Seed | b0331 | CRP | + | AAACGTTAACTGAAACGCATATT |
![[View full size image]](./ExpressionProfiles/ExpressionProfile_extend_module_145.png){kind=link}