Number of motifs Number of conditions Number of seed genes Number of extended seed genes Correlation extended seed No. (putative) regulators in module | = = = = = = | 1 36 4 4 0.95322 0 | [View full size image] | [View full size image] |
Motif | Motif logo | Module motif logo |
---|---|---|
CRP: cyclic AMP receptor protein |
Gene | Seed/Extended Seed | Description | Direct interaction (RegulonDB) | Indirect interaction (RegulonDB) | Motif instance |
---|---|---|---|---|---|
b1188 (ycgB) | Seed | putative sporulation protein |    | TATGGTGAGCTGGCTCACATCTC | |
b0957 (ompA) | Seed | outer membrane protein 3a (II*;G;d) | CRP | + | ATGCCTGACGGAGTTCACACTTG |
b0459 (maa) | Seed | Maa |    | CTATGTGATCTTTATCACACAGA | |
b0331 (prpB) | Seed | b0331 | CRP | + | AAACGTTAACTGAAACGCATATT |