Number of motifs Number of conditions Number of seed genes Number of extended seed genes Correlation extended seed No. (putative) regulators in module | = = = = = = | 1 71 4 4 0.9216 1 | [View full size image] | [View full size image] |
Motif | Motif logo | Module motif logo |
---|---|---|
CRP: cyclic AMP receptor protein |
Gene | Seed/Extended Seed | Description | Direct interaction (RegulonDB) | Indirect interaction (RegulonDB) | Motif instance |
---|---|---|---|---|---|
b2801 (fucP) | Seed | FucP fucose MFS transporter | CRP | + | TTTTGTGACCTGGTTCAACTAAT |
b1040 (csgD) | Seed | CsgD transcriptional dual regulator | CRP | + | TTTAGTTACATGTTTAACACTTG |
b0041 (fixA) | Seed | probable flavoprotein subunit required for anaerobic carnitine metabolism | CRP | + | TTCTGTGATTGGTATCACATTTT |
b3904 (rhaB) | Seed | b3904 | CRP | + | AATTGTGAACATCATCACGTTCA |