Number of conditions
Number of seed genes
Number of extended seed genes
Correlation extended seed
No. (putative) regulators in module
=
=
=
=
=
71
4
4
0.9216
1
[View full size image]
![[View full size image]](./ExpressionProfiles/ExpressionProfile_seed_module_144.png){kind=link}
[View full size image]
| Number of motifs Number of conditions Number of seed genes Number of extended seed genes Correlation extended seed No. (putative) regulators in module | = = = = = = | 1 71 4 4 0.9216 1 | [View full size image] | [View full size image] |
| Motif | Motif logo | Module motif logo |
|---|---|---|
| CRP: cyclic AMP receptor protein |  |  |
| Gene | Seed/Extended Seed | Description | Direct interaction (RegulonDB) | Indirect interaction (RegulonDB) | Motif instance |
|---|---|---|---|---|---|
| b2801 (fucP) | Seed | FucP fucose MFS transporter | CRP | + | TTTTGTGACCTGGTTCAACTAAT |
| b1040 (csgD) | Seed | CsgD transcriptional dual regulator | CRP | + | TTTAGTTACATGTTTAACACTTG |
| b0041 (fixA) | Seed | probable flavoprotein subunit required for anaerobic carnitine metabolism | CRP | + | TTCTGTGATTGGTATCACATTTT |
| b3904 (rhaB) | Seed | b3904 | CRP | + | AATTGTGAACATCATCACGTTCA |
![[View full size image]](./ExpressionProfiles/ExpressionProfile_extend_module_144.png){kind=link}