Number of conditions
Number of seed genes
Number of extended seed genes
Correlation extended seed
No. (putative) regulators in module
=
=
=
=
=
67
4
4
0.94039
2
[View full size image]
![[View full size image]](./ExpressionProfiles/ExpressionProfile_seed_module_143.png){kind=link}
[View full size image]
| Number of motifs Number of conditions Number of seed genes Number of extended seed genes Correlation extended seed No. (putative) regulators in module | = = = = = = | 1 67 4 4 0.94039 2 | [View full size image] | [View full size image] |
| Motif | Motif logo | Module motif logo |
|---|---|---|
| CRP: cyclic AMP receptor protein |  |  |
| Gene | Seed/Extended Seed | Description | Direct interaction (RegulonDB) | Indirect interaction (RegulonDB) | Motif instance |
|---|---|---|---|---|---|
| b3357 (crp) | Seed | CRP transcriptional dual regulator | CRP | +- | GTATGCAAAGGACGTCACATTAC |
| b2913 (serA) | Seed | SerA | CRP | + | TTTGGTGACATGTGTCACGCTTT |
| b1685 (ydiH) | Seed | predicted protein | | GTTTGTGCTGTTCGTCACGATTG | |
| b0113 (pdhR) | Seed | PdhR transcriptional dual regulator | CRP | + | AAATGTGCACAGTTTCATGATTT |
![[View full size image]](./ExpressionProfiles/ExpressionProfile_extend_module_143.png){kind=link}