Number of motifs Number of conditions Number of seed genes Number of extended seed genes Correlation extended seed No. (putative) regulators in module | = = = = = = | 1 67 4 4 0.94039 2 | [View full size image] | [View full size image] |
Motif | Motif logo | Module motif logo |
---|---|---|
CRP: cyclic AMP receptor protein |
Gene | Seed/Extended Seed | Description | Direct interaction (RegulonDB) | Indirect interaction (RegulonDB) | Motif instance |
---|---|---|---|---|---|
b3357 (crp) | Seed | CRP transcriptional dual regulator | CRP | +- | GTATGCAAAGGACGTCACATTAC |
b2913 (serA) | Seed | SerA | CRP | + | TTTGGTGACATGTGTCACGCTTT |
b1685 (ydiH) | Seed | predicted protein |    | GTTTGTGCTGTTCGTCACGATTG | |
b0113 (pdhR) | Seed | PdhR transcriptional dual regulator | CRP | + | AAATGTGCACAGTTTCATGATTT |