Number of motifs Number of conditions Number of seed genes Number of extended seed genes Correlation extended seed No. (putative) regulators in module | = = = = = = | 1 76 4 4 0.90007 0 | [View full size image] | [View full size image] |
Motif | Motif logo | Module motif logo |
---|---|---|
CRP: cyclic AMP receptor protein |
Gene | Seed/Extended Seed | Description | Direct interaction (RegulonDB) | Indirect interaction (RegulonDB) | Motif instance |
---|---|---|---|---|---|
b3225 (nanA) | Seed | NanA | CRP | + | TTTAGTGAAGCAGATCGCATTAT |
b1612 (fumA) | Seed | fumarase A monomer | CRP | + | GTGAGAGAACAATGTCAAACAAA |
b3672 (ivbL) | Seed | ilvB operon leader peptide | CRP | + | AAACGTGATCAACCCCTCAATTT |
b1778 (msrB) | Seed | methionine sulfoxide reductase B |    | AAATGTGATTTTCATCACGATTT |