Number of conditions
Number of seed genes
Number of extended seed genes
Correlation extended seed
No. (putative) regulators in module
=
=
=
=
=
76
4
4
0.90007
0
[View full size image]
![[View full size image]](./ExpressionProfiles/ExpressionProfile_seed_module_142.png){kind=link}
[View full size image]
| Number of motifs Number of conditions Number of seed genes Number of extended seed genes Correlation extended seed No. (putative) regulators in module | = = = = = = | 1 76 4 4 0.90007 0 | [View full size image] | [View full size image] |
| Motif | Motif logo | Module motif logo |
|---|---|---|
| CRP: cyclic AMP receptor protein |  |  |
| Gene | Seed/Extended Seed | Description | Direct interaction (RegulonDB) | Indirect interaction (RegulonDB) | Motif instance |
|---|---|---|---|---|---|
| b3225 (nanA) | Seed | NanA | CRP | + | TTTAGTGAAGCAGATCGCATTAT |
| b1612 (fumA) | Seed | fumarase A monomer | CRP | + | GTGAGAGAACAATGTCAAACAAA |
| b3672 (ivbL) | Seed | ilvB operon leader peptide | CRP | + | AAACGTGATCAACCCCTCAATTT |
| b1778 (msrB) | Seed | methionine sulfoxide reductase B | | AAATGTGATTTTCATCACGATTT |
![[View full size image]](./ExpressionProfiles/ExpressionProfile_extend_module_142.png){kind=link}