Number of conditions
Number of seed genes
Number of extended seed genes
Correlation extended seed
No. (putative) regulators in module
=
=
=
=
=
100
4
4
0.94577
0
[View full size image]
![[View full size image]](./ExpressionProfiles/ExpressionProfile_seed_module_141.png){kind=link}
[View full size image]
| Number of motifs Number of conditions Number of seed genes Number of extended seed genes Correlation extended seed No. (putative) regulators in module | = = = = = = | 1 100 4 4 0.94577 0 | [View full size image] | [View full size image] |
| Motif | Motif logo | Module motif logo |
|---|---|---|
| CRP: cyclic AMP receptor protein |  |  |
| Gene | Seed/Extended Seed | Description | Direct interaction (RegulonDB) | Indirect interaction (RegulonDB) | Motif instance |
|---|---|---|---|---|---|
| b1704 (aroH) | Seed | AroH | | TATCGTGATGCGCATCACTTCCC | |
| b0125 (hpt) | Seed | b0125 | CRP | + | ATGTGTGATCGTCATCACAATTC |
| b3363 (ppiA) | Seed | peptidyl-prolyl cis-trans isomerase A (rotamase A) | CRP | +- | AGAGGTGATTTTGATCACGGAAT |
| b3806 (cyaA) | Seed | b3806 | CRP | - | AGGTGTTAAATTGATCACGTTTT |
![[View full size image]](./ExpressionProfiles/ExpressionProfile_extend_module_141.png){kind=link}