Number of motifs Number of conditions Number of seed genes Number of extended seed genes Correlation extended seed No. (putative) regulators in module | = = = = = = | 1 100 4 4 0.94577 0 | [View full size image] | [View full size image] |
Motif | Motif logo | Module motif logo |
---|---|---|
CRP: cyclic AMP receptor protein |
Gene | Seed/Extended Seed | Description | Direct interaction (RegulonDB) | Indirect interaction (RegulonDB) | Motif instance |
---|---|---|---|---|---|
b1704 (aroH) | Seed | AroH |    | TATCGTGATGCGCATCACTTCCC | |
b0125 (hpt) | Seed | b0125 | CRP | + | ATGTGTGATCGTCATCACAATTC |
b3363 (ppiA) | Seed | peptidyl-prolyl cis-trans isomerase A (rotamase A) | CRP | +- | AGAGGTGATTTTGATCACGGAAT |
b3806 (cyaA) | Seed | b3806 | CRP | - | AGGTGTTAAATTGATCACGTTTT |