Number of motifs Number of conditions Number of seed genes Number of extended seed genes Correlation extended seed No. (putative) regulators in module | = = = = = = | 1 44 4 4 0.94903 0 | ![]() [View full size image] | ![]() [View full size image] |
Motif | Motif logo | Module motif logo |
---|---|---|
CRP: cyclic AMP receptor protein | ![]() | ![]() |
Gene | Seed/Extended Seed | Description | Direct interaction (RegulonDB) | Indirect interaction (RegulonDB) | Motif instance |
---|---|---|---|---|---|
b0898 (ycaD) | Seed | YcaD MFS transporter |    | AAATTTGAACTTCCTCACGGTTT | |
b3830 (ysgA) | Seed | predicted hydrolase |    | AAAAGTGATGCAAATCACATAAA | |
b0822 (ybiV) | Seed | sugar phosphatase |    | ATTTGTGCTCTGCGTCACATTGT | |
b2942 (metK) | Seed | MetK S-adenosylmethionine synthetase monomer | CRP | - | TGATATTAAATATGGCAAAACAC |