Number of conditions
Number of seed genes
Number of extended seed genes
Correlation extended seed
No. (putative) regulators in module
=
=
=
=
=
64
4
4
0.93977
1
[View full size image]
![[View full size image]](./ExpressionProfiles/ExpressionProfile_seed_module_139.png){kind=link}
[View full size image]
| Number of motifs Number of conditions Number of seed genes Number of extended seed genes Correlation extended seed No. (putative) regulators in module | = = = = = = | 1 64 4 4 0.93977 1 | [View full size image] | [View full size image] |
| Motif | Motif logo | Module motif logo |
|---|---|---|
| CRP: cyclic AMP receptor protein |  |  |
| Gene | Seed/Extended Seed | Description | Direct interaction (RegulonDB) | Indirect interaction (RegulonDB) | Motif instance |
|---|---|---|---|---|---|
| b3405 (ompR) | Seed | OmpR | CRP | +- | TAACGTGATCATATCAACAGAAT |
| b1139 (lit) | Seed | Lit, cell death peptidase; phage exclusion; e14 prophage | | TATTGTGATCAGTAGCACGTATC | |
| b0763 (modA) | Seed | ModA | CRP | + | TTTTCTTATCTACCTCACAAAGG |
| b3947 (ptsA) | Seed | PEP-protein phosphotransferase system enzyme I | | AAATGCGATCCGCCTCATAACTT |
![[View full size image]](./ExpressionProfiles/ExpressionProfile_extend_module_139.png){kind=link}