Number of motifs Number of conditions Number of seed genes Number of extended seed genes Correlation extended seed No. (putative) regulators in module | = = = = = = | 1 64 4 4 0.93977 1 | ![]() [View full size image] | ![]() [View full size image] |
Motif | Motif logo | Module motif logo |
---|---|---|
CRP: cyclic AMP receptor protein | ![]() | ![]() |
Gene | Seed/Extended Seed | Description | Direct interaction (RegulonDB) | Indirect interaction (RegulonDB) | Motif instance |
---|---|---|---|---|---|
b3405 (ompR) | Seed | OmpR | CRP | +- | TAACGTGATCATATCAACAGAAT |
b1139 (lit) | Seed | Lit, cell death peptidase; phage exclusion; e14 prophage |    | TATTGTGATCAGTAGCACGTATC | |
b0763 (modA) | Seed | ModA | CRP | + | TTTTCTTATCTACCTCACAAAGG |
b3947 (ptsA) | Seed | PEP-protein phosphotransferase system enzyme I |    | AAATGCGATCCGCCTCATAACTT |