Number of motifs Number of conditions Number of seed genes Number of extended seed genes Correlation extended seed No. (putative) regulators in module | = = = = = = | 1 40 5 10 0.89449 2 | ![]() [View full size image] | ![]() [View full size image] |
Motif | Motif logo | Module motif logo |
---|---|---|
CRP: cyclic AMP receptor protein | ![]() | ![]() |
Gene | Seed/Extended Seed | Description | Direct interaction (RegulonDB) | Indirect interaction (RegulonDB) | Motif instance |
---|---|---|---|---|---|
b1189 (dadA) | Seed | D-amino acid dehydrogenase, small subunit | CRP | +- | AGATGTGAGCCAGCTCACCATAA |
b4354 (yjiY) | Seed | predicted inner membrane protein |    | ATATGTGATATGAATCACATATT | |
b3748 (rbsD) | Seed | D-ribose utilization | CRP | + | CGTTTCGAGGTTGATCACATTTC |
b0598 (cstA) | Seed | peptide transporter induced by carbon starvation | CRP | + | CGGAGTGATCGAGTTAACATTGT |
b4118 (melR) | Seed | MelR transcriptional dual regulator | CRP | + | AACCGTGCTCCCACTCGCAGTCA |
b2535 (csiE) | Extension | stationary phase inducible protein | CRP | + | TTCTGTGACGCTTGCCAACATTT |
b2869 (ygeV) | Extension | putative transcriptional regulator |    | ATGTGTGGGGTTGATCACAAATT | |
b1190 (dadX) | Extension |    | +- |    | |
b3239 (yhcO) | Extension | predicted barnase inhibitor |    | AAACGTGACGGTGGCAACAGATG | |
b1814 (sdaA) | Extension |    | ACTTGAGACAATCATCGCAATAT |