Number of conditions
Number of seed genes
Number of extended seed genes
Correlation extended seed
No. (putative) regulators in module
=
=
=
=
=
43
5
5
0.96649
2
[View full size image]
![[View full size image]](./ExpressionProfiles/ExpressionProfile_seed_module_137.png){kind=link}
[View full size image]
| Number of motifs Number of conditions Number of seed genes Number of extended seed genes Correlation extended seed No. (putative) regulators in module | = = = = = = | 1 43 5 5 0.96649 2 | [View full size image] | [View full size image] |
| Motif | Motif logo | Module motif logo |
|---|---|---|
| CRP: cyclic AMP receptor protein |  |  |
| Gene | Seed/Extended Seed | Description | Direct interaction (RegulonDB) | Indirect interaction (RegulonDB) | Motif instance |
|---|---|---|---|---|---|
| b4003 (zraS) | Seed | ZraS | CRP | + | AGATGCGTTTTATGCAACGTTCT |
| b3093 (exuT) | Seed | ExuT hexuronate MFS transporter | | + | ATTTGTGATGGCTCTCACCTTTT |
| b0268 (yagE) | Seed | CP4-6 prophage; predicted lyase/synthase | | ATATGTGATCCAGCTTAAATTTC | |
| b2151 (galS) | Seed | GalS transcriptional dual regulator | CRP | + | TGCTGTGACTCGATTCACGAAGT |
| b4321 (gntP) | Seed | GntP Gluconate Gnt transporter | CRP | + | GGATGTGACATTCATCGCAACAA |
![[View full size image]](./ExpressionProfiles/ExpressionProfile_extend_module_137.png){kind=link}