Number of motifs Number of conditions Number of seed genes Number of extended seed genes Correlation extended seed No. (putative) regulators in module | = = = = = = | 1 43 5 5 0.96649 2 | [View full size image] | [View full size image] |
Motif | Motif logo | Module motif logo |
---|---|---|
CRP: cyclic AMP receptor protein |
Gene | Seed/Extended Seed | Description | Direct interaction (RegulonDB) | Indirect interaction (RegulonDB) | Motif instance |
---|---|---|---|---|---|
b4003 (zraS) | Seed | ZraS | CRP | + | AGATGCGTTTTATGCAACGTTCT |
b3093 (exuT) | Seed | ExuT hexuronate MFS transporter |    | + | ATTTGTGATGGCTCTCACCTTTT |
b0268 (yagE) | Seed | CP4-6 prophage; predicted lyase/synthase |    | ATATGTGATCCAGCTTAAATTTC | |
b2151 (galS) | Seed | GalS transcriptional dual regulator | CRP | + | TGCTGTGACTCGATTCACGAAGT |
b4321 (gntP) | Seed | GntP Gluconate Gnt transporter | CRP | + | GGATGTGACATTCATCGCAACAA |