Number of motifs Number of conditions Number of seed genes Number of extended seed genes Correlation extended seed No. (putative) regulators in module | = = = = = = | 1 44 5 7 0.91754 0 | [View full size image] | [View full size image] |
Motif | Motif logo | Module motif logo |
---|---|---|
CRP: cyclic AMP receptor protein |
Gene | Seed/Extended Seed | Description | Direct interaction (RegulonDB) | Indirect interaction (RegulonDB) | Motif instance |
---|---|---|---|---|---|
b2870 (ygeW) | Seed | putative carbamoyltransferase |    | ATTTGTGATCAACCCCACACATT | |
b3666 (uhpT) | Seed | UhpT-hexose phosphate MFS transporter | CRP | + | TTTGCTGCTGATTTTTACAATGC |
b2841 (araE) | Seed | AraE arabinose MFS transporter | CRP | + | AATTGGAATATCCATCACATAAC |
b2775 (yqcE) | Seed | YqcE MFS transporter |    | TAATGTGATCGTAATCACAGTGT | |
b3452 (ugpA) | Seed | UgpA | CRP | + | ATGTCGGATGCGTTTCGCTTATC |
b2715 (ascF) | Extension | AscF |    | TCAGGTGACCGGTTTCACAAATA | |
b3683 (glvC) | Extension | GlvC |    | TCATGTTCTGCCGATCGCATCTT |