Number of conditions
Number of seed genes
Number of extended seed genes
Correlation extended seed
No. (putative) regulators in module
=
=
=
=
=
44
5
7
0.91754
0
[View full size image]
![[View full size image]](./ExpressionProfiles/ExpressionProfile_seed_module_117.png){kind=link}
[View full size image]
| Number of motifs Number of conditions Number of seed genes Number of extended seed genes Correlation extended seed No. (putative) regulators in module | = = = = = = | 1 44 5 7 0.91754 0 | [View full size image] | [View full size image] |
| Motif | Motif logo | Module motif logo |
|---|---|---|
| CRP: cyclic AMP receptor protein |  |  |
| Gene | Seed/Extended Seed | Description | Direct interaction (RegulonDB) | Indirect interaction (RegulonDB) | Motif instance |
|---|---|---|---|---|---|
| b2870 (ygeW) | Seed | putative carbamoyltransferase | | ATTTGTGATCAACCCCACACATT | |
| b3666 (uhpT) | Seed | UhpT-hexose phosphate MFS transporter | CRP | + | TTTGCTGCTGATTTTTACAATGC |
| b2841 (araE) | Seed | AraE arabinose MFS transporter | CRP | + | AATTGGAATATCCATCACATAAC |
| b2775 (yqcE) | Seed | YqcE MFS transporter | | TAATGTGATCGTAATCACAGTGT | |
| b3452 (ugpA) | Seed | UgpA | CRP | + | ATGTCGGATGCGTTTCGCTTATC |
| b2715 (ascF) | Extension | AscF | | TCAGGTGACCGGTTTCACAAATA | |
| b3683 (glvC) | Extension | GlvC | | TCATGTTCTGCCGATCGCATCTT |
![[View full size image]](./ExpressionProfiles/ExpressionProfile_extend_module_117.png){kind=link}