Number of motifs Number of conditions Number of seed genes Number of extended seed genes Correlation extended seed No. (putative) regulators in module | = = = = = = | 1 143 5 11 0.87406 0 | [View full size image] | [View full size image] |
Motif | Motif logo | Module motif logo |
---|---|---|
CRP: cyclic AMP receptor protein |
Gene | Seed/Extended Seed | Description | Direct interaction (RegulonDB) | Indirect interaction (RegulonDB) | Motif instance |
---|---|---|---|---|---|
b1493 (gadB) | Seed | glutamate decarboxylase B subunit | CRP | - | ATTCGCGTAATATCTCACGATAA |
b2597 (raiA) | Seed | stationary phase translation inhibitor and ribosome stability factor |    | TTATGAGATTTTCATCACACATT | |
b3049 (glgS) | Seed | predicted glycogen synthesis protein | CRP | + | AAGTGTGATCGGGGACAATATAT |
b0953 (rmf) | Seed | ribosome modulation factor |    | AAATTTGTTCCTCTTCACATTTT | |
b3517 (gadA) | Seed | glutamate decarboxylase A subunit | CRP | - | TTGGGCGATTTTTATTACGATAA |
b0486 (ybaT) | Extension | YbaT APC transporter |    | AACAGTGTTCGCGGTCAAAAAAT | |
b2097 (fbaB) | Extension | fructose bisphosphate aldolase monomer |    | AAACTTGACCGCGCTAACATTTT | |
b0485 (ybaS) | Extension | predicted glutaminase |    |    | |
b3509 (hdeB) | Extension | acid stress chaperone |    |    | |
b3510 (hdeA) | Extension | acid-resistance protein, possible chaperone |    | ATTCGTGACGGCTCTTTCACTTT | |
b1492 (gadC) | Extension | GadC GABA APC transporter |    | - | TAAAGCTAAGCAGCTCACATTAC |