Number of conditions
Number of seed genes
Number of extended seed genes
Correlation extended seed
No. (putative) regulators in module
=
=
=
=
=
86
4
5
0.90309
0
[View full size image]
![[View full size image]](./ExpressionProfiles/ExpressionProfile_seed_module_113.png){kind=link}
[View full size image]
| Number of motifs Number of conditions Number of seed genes Number of extended seed genes Correlation extended seed No. (putative) regulators in module | = = = = = = | 1 86 4 5 0.90309 0 | [View full size image] | [View full size image] |
| Motif | Motif logo | Module motif logo |
|---|---|---|
| Fis: Activates ribosomal RNA transcription. Plays a direct role in upstream activation of rRNA promoters |  |  |
| Gene | Seed/Extended Seed | Description | Direct interaction (RegulonDB) | Indirect interaction (RegulonDB) | Motif instance |
|---|---|---|---|---|---|
| b3365 (nirB) | Seed | nitrite reductase, large subunit | Fis | - | AATCGAGGCAAAAATGAGCAAA |
| b4070 (nrfA) | Seed | b4070 | Fis | - | AATTGTGCAAATAAACGGCAGG |
| b2398 (yfeC) | Seed | predicted DNA-binding transcriptional regulator | | AATCGCTGAAAAATCAGGCAAA | |
| b2296 (ackA) | Seed | b2296 | | CATTGGCTGAAAATTACGCAAA | |
| b4073 (nrfD) | Extension | | - | |
![[View full size image]](./ExpressionProfiles/ExpressionProfile_extend_module_113.png){kind=link}