Number of motifs Number of conditions Number of seed genes Number of extended seed genes Correlation extended seed No. (putative) regulators in module | = = = = = = | 1 86 4 5 0.90309 0 | [View full size image] | [View full size image] |
Motif | Motif logo | Module motif logo |
---|---|---|
Fis: Activates ribosomal RNA transcription. Plays a direct role in upstream activation of rRNA promoters |
Gene | Seed/Extended Seed | Description | Direct interaction (RegulonDB) | Indirect interaction (RegulonDB) | Motif instance |
---|---|---|---|---|---|
b3365 (nirB) | Seed | nitrite reductase, large subunit | Fis | - | AATCGAGGCAAAAATGAGCAAA |
b4070 (nrfA) | Seed | b4070 | Fis | - | AATTGTGCAAATAAACGGCAGG |
b2398 (yfeC) | Seed | predicted DNA-binding transcriptional regulator |    | AATCGCTGAAAAATCAGGCAAA | |
b2296 (ackA) | Seed | b2296 |    | CATTGGCTGAAAATTACGCAAA | |
b4073 (nrfD) | Extension |    | - |    |