Number of motifs Number of conditions Number of seed genes Number of extended seed genes Correlation extended seed No. (putative) regulators in module | = = = = = = | 1 91 4 4 0.95028 0 | ![]() [View full size image] | ![]() [View full size image] |
Motif | Motif logo | Module motif logo |
---|---|---|
Fis: Activates ribosomal RNA transcription. Plays a direct role in upstream activation of rRNA promoters | ![]() | ![]() |
Gene | Seed/Extended Seed | Description | Direct interaction (RegulonDB) | Indirect interaction (RegulonDB) | Motif instance |
---|---|---|---|---|---|
b3699 (gyrB) | Seed | DNA gyrase, subunit B | Fis | - | TGTCGGACGAAAATTCGAAGAT |
b2821 (ptrA) | Seed | protease III |    | TGCTGTATAAAAATTGCGCAAT | |
b2231 (gyrA) | Seed | DNA gyrase, subunit A | Fis | - | CATTGGATGTGAATAAAGCGTA |
b0779 (uvrB) | Seed | DNA repair; excision nuclease subunit B |    | GATTGACTGCAATTTAACCAAT |