Number of motifs Number of conditions Number of seed genes Number of extended seed genes Correlation extended seed No. (putative) regulators in module | = = = = = = | 1 101 4 4 0.94689 0 | [View full size image] | [View full size image] |
Motif | Motif logo | Module motif logo |
---|---|---|
Fis: Activates ribosomal RNA transcription. Plays a direct role in upstream activation of rRNA promoters |
Gene | Seed/Extended Seed | Description | Direct interaction (RegulonDB) | Indirect interaction (RegulonDB) | Motif instance |
---|---|---|---|---|---|
b1101 (ptsG) | Seed | PtsG | Fis | +- | AATTGGGCGGTGAATAACCACG |
b1109 (ndh) | Seed | NADH dehydrogenase II | Fis | +- | ATTCGCTCAAATAATAAACAAT |
b2927 (epd) | Seed | Epd |    | AGTCGATTAAATGTTCGACAAT | |
b2231 (gyrA) | Seed | DNA gyrase, subunit A | Fis | - | CATTGGATGTGAATAAAGCGTA |