Number of conditions
Number of seed genes
Number of extended seed genes
Correlation extended seed
No. (putative) regulators in module
=
=
=
=
=
48
4
4
0.95312
1
[View full size image]
![[View full size image]](./ExpressionProfiles/ExpressionProfile_seed_module_108.png){kind=link}
[View full size image]
| Number of motifs Number of conditions Number of seed genes Number of extended seed genes Correlation extended seed No. (putative) regulators in module | = = = = = = | 1 48 4 4 0.95312 1 | [View full size image] | [View full size image] |
| Motif | Motif logo | Module motif logo |
|---|---|---|
| Mlc: |  |  |
| Gene | Seed/Extended Seed | Description | Direct interaction (RegulonDB) | Indirect interaction (RegulonDB) | Motif instance |
|---|---|---|---|---|---|
| b0796 (ybiH) | Seed | predicted DNA-binding transcriptional regulator | | TTGTGACGCAGCGCATAAATTATC | |
| b0426 (yajQ) | Seed | nucleotide binding protein | | GTATTATGCTTCGCATCAAAAATG | |
| b3147 (yraM) | Seed | putative glycosylase | | ATATTGAGCATTGCGTAAAAAAAA | |
| b1817 (manX) | Seed | ManX | Mlc | TTTTTTCGATATCTAAAATAAATC |
![[View full size image]](./ExpressionProfiles/ExpressionProfile_extend_module_108.png){kind=link}