Number of motifs Number of conditions Number of seed genes Number of extended seed genes Correlation extended seed No. (putative) regulators in module | = = = = = = | 1 48 4 4 0.95312 1 | [View full size image] | [View full size image] |
Motif | Motif logo | Module motif logo |
---|---|---|
Mlc: |
Gene | Seed/Extended Seed | Description | Direct interaction (RegulonDB) | Indirect interaction (RegulonDB) | Motif instance |
---|---|---|---|---|---|
b0796 (ybiH) | Seed | predicted DNA-binding transcriptional regulator |    | TTGTGACGCAGCGCATAAATTATC | |
b0426 (yajQ) | Seed | nucleotide binding protein |    | GTATTATGCTTCGCATCAAAAATG | |
b3147 (yraM) | Seed | putative glycosylase |    | ATATTGAGCATTGCGTAAAAAAAA | |
b1817 (manX) | Seed | ManX | Mlc | TTTTTTCGATATCTAAAATAAATC |