Number of motifs Number of conditions Number of seed genes Number of extended seed genes Correlation extended seed No. (putative) regulators in module | = = = = = = | 1 41 4 4 0.94935 2 | [View full size image] | [View full size image] |
Motif | Motif logo | Module motif logo |
---|---|---|
Mlc: |
Gene | Seed/Extended Seed | Description | Direct interaction (RegulonDB) | Indirect interaction (RegulonDB) | Motif instance |
---|---|---|---|---|---|
b1594 (dgsA) | Seed | DgsA transcriptional repressor | Mlc | TTATTTCGGAGCGCGAAAATATAG | |
b3884 (yihW) | Seed | predicted DNA-binding transcriptional regulator |    | TTTTGTCACTTTTTGTATAAAATG | |
b3862 (yihG) | Seed | predicted endonuclease |    | TTTTCATGCAGTTAAAAATAAATC | |
b3900 (frvA) | Seed | FrvA |    | AAATTTCGATTTGAAAAATTAAAC |