Number of conditions
Number of seed genes
Number of extended seed genes
Correlation extended seed
No. (putative) regulators in module
=
=
=
=
=
41
4
4
0.94935
2
[View full size image]
![[View full size image]](./ExpressionProfiles/ExpressionProfile_seed_module_107.png){kind=link}
[View full size image]
| Number of motifs Number of conditions Number of seed genes Number of extended seed genes Correlation extended seed No. (putative) regulators in module | = = = = = = | 1 41 4 4 0.94935 2 | [View full size image] | [View full size image] |
| Motif | Motif logo | Module motif logo |
|---|---|---|
| Mlc: |  |  |
| Gene | Seed/Extended Seed | Description | Direct interaction (RegulonDB) | Indirect interaction (RegulonDB) | Motif instance |
|---|---|---|---|---|---|
| b1594 (dgsA) | Seed | DgsA transcriptional repressor | Mlc | TTATTTCGGAGCGCGAAAATATAG | |
| b3884 (yihW) | Seed | predicted DNA-binding transcriptional regulator | | TTTTGTCACTTTTTGTATAAAATG | |
| b3862 (yihG) | Seed | predicted endonuclease | | TTTTCATGCAGTTAAAAATAAATC | |
| b3900 (frvA) | Seed | FrvA | | AAATTTCGATTTGAAAAATTAAAC |
![[View full size image]](./ExpressionProfiles/ExpressionProfile_extend_module_107.png){kind=link}