Number of conditions
Number of seed genes
Number of extended seed genes
Correlation extended seed
No. (putative) regulators in module
=
=
=
=
=
101
4
5
0.91832
0
[View full size image]
![[View full size image]](./ExpressionProfiles/ExpressionProfile_seed_module_103.png){kind=link}
[View full size image]
| Number of motifs Number of conditions Number of seed genes Number of extended seed genes Correlation extended seed No. (putative) regulators in module | = = = = = = | 1 101 4 5 0.91832 0 | [View full size image] | [View full size image] |
| Motif | Motif logo | Module motif logo |
|---|---|---|
| LexA: Represses a number of genes involved in the response to DNA damage |  |  |
| Gene | Seed/Extended Seed | Description | Direct interaction (RegulonDB) | Indirect interaction (RegulonDB) | Motif instance |
|---|---|---|---|---|---|
| b0060 (polB) | Seed | DNA polymerase II | LexA | - | ACTGTATAAAACCACAGCCAA |
| b2009 (sbmC) | Seed | DNA gyrase inhibitor | | ACTGTATATAAAAACAGTATC | |
| b0226 (dinJ) | Seed | antitoxin of YafQ-DinJ toxin-antitoxin system | | GCTGAATAAATATACAGCACA | |
| b0779 (uvrB) | Seed | DNA repair; excision nuclease subunit B | LexA | - | ACTGTTTTTTTATCCAGTATA |
| b0019 (nhaA) | Extension | sodium/proton NhaA transporter | | ACTCTACATGTGTTCAGCATA |
![[View full size image]](./ExpressionProfiles/ExpressionProfile_extend_module_103.png){kind=link}