Number of motifs Number of conditions Number of seed genes Number of extended seed genes Correlation extended seed No. (putative) regulators in module | = = = = = = | 1 101 4 5 0.91832 0 | [View full size image] | [View full size image] |
Motif | Motif logo | Module motif logo |
---|---|---|
LexA: Represses a number of genes involved in the response to DNA damage |
Gene | Seed/Extended Seed | Description | Direct interaction (RegulonDB) | Indirect interaction (RegulonDB) | Motif instance |
---|---|---|---|---|---|
b0060 (polB) | Seed | DNA polymerase II | LexA | - | ACTGTATAAAACCACAGCCAA |
b2009 (sbmC) | Seed | DNA gyrase inhibitor |    | ACTGTATATAAAAACAGTATC | |
b0226 (dinJ) | Seed | antitoxin of YafQ-DinJ toxin-antitoxin system |    | GCTGAATAAATATACAGCACA | |
b0779 (uvrB) | Seed | DNA repair; excision nuclease subunit B | LexA | - | ACTGTTTTTTTATCCAGTATA |
b0019 (nhaA) | Extension | sodium/proton NhaA transporter |    | ACTCTACATGTGTTCAGCATA |