Number of motifs Number of conditions Number of seed genes Number of extended seed genes Correlation extended seed No. (putative) regulators in module | = = = = = = | 1 75 4 4 0.96358 0 | [View full size image] | [View full size image] |
Motif | Motif logo | Module motif logo |
---|---|---|
LexA: Represses a number of genes involved in the response to DNA damage |
Gene | Seed/Extended Seed | Description | Direct interaction (RegulonDB) | Indirect interaction (RegulonDB) | Motif instance |
---|---|---|---|---|---|
b4058 (uvrA) | Seed | excision nuclease subunit A | LexA | - | ACTGTATATTCATTCAGGTCA |
b3813 (uvrD) | Seed | DNA-dependent ATPase I and helicase II | LexA | - | TCTGTATATATACCCAGCTTT |
b0779 (uvrB) | Seed | DNA repair; excision nuclease subunit B | LexA | - | ACTGTTTTTTTATCCAGTATA |
b0685 (ybfE) | Seed | LexA-regulated protein |    | ACTGATTAAAAACCCAGCGTC |