Number of conditions
Number of seed genes
Number of extended seed genes
Correlation extended seed
No. (putative) regulators in module
=
=
=
=
=
75
4
4
0.96358
0
[View full size image]
![[View full size image]](./ExpressionProfiles/ExpressionProfile_seed_module_102.png){kind=link}
[View full size image]
| Number of motifs Number of conditions Number of seed genes Number of extended seed genes Correlation extended seed No. (putative) regulators in module | = = = = = = | 1 75 4 4 0.96358 0 | [View full size image] | [View full size image] |
| Motif | Motif logo | Module motif logo |
|---|---|---|
| LexA: Represses a number of genes involved in the response to DNA damage |  |  |
| Gene | Seed/Extended Seed | Description | Direct interaction (RegulonDB) | Indirect interaction (RegulonDB) | Motif instance |
|---|---|---|---|---|---|
| b4058 (uvrA) | Seed | excision nuclease subunit A | LexA | - | ACTGTATATTCATTCAGGTCA |
| b3813 (uvrD) | Seed | DNA-dependent ATPase I and helicase II | LexA | - | TCTGTATATATACCCAGCTTT |
| b0779 (uvrB) | Seed | DNA repair; excision nuclease subunit B | LexA | - | ACTGTTTTTTTATCCAGTATA |
| b0685 (ybfE) | Seed | LexA-regulated protein | | ACTGATTAAAAACCCAGCGTC |
![[View full size image]](./ExpressionProfiles/ExpressionProfile_extend_module_102.png){kind=link}